THIS IS A SOURCES SOUGHT NOTICE ONLY. This notice does not constitute a commitment
by the Government. All information submitted in response to this announcement is
voluntary, and the Government will not pay for information requested nor will it compensate
any respondent for any cost incurred in developing information provided to the Government.
NOAAʼs Atlantic Oceanographic and Meteorological Laboratory (AOML), Ocean Chemistry and
Ecosystems Division, is seeking a contractor to provide the following:
1. Amplicon sequencing library preparation:
1. Must be able to prepare any type (target region) of amplicon libraries from
marine environmental DNA (“eDNA”).
2. Must use a two-step PCR approach. The first PCR uses target-specific primers
with tags on the 5ʼ ends that allow the contractor to do a second PCR for
barcoding. The submitter will perform the primary PCR reaction.
3. The submitter will order primers with the following tags on the 5ʼ ends, with
the target-specific forward and reverse sequences inserted in [TS-For] and [TSRev],
respectively:
1. CS1-TS-F: 5ʼ – ACACTGACGACATGGTTCTACA – [TS-For] – 3ʼ
2. CS2-TS-R: 5ʼ – TACGGTAGCAGAGACTTGGTCT – [TS-Rev] – 3ʼ
4. Accept PCR products up to 400 bp (not including adapter overhangs). This size
will permit adequate overlap of the forward and reverse read 3' ends when
sequencing with a 2 x 250bp format.
5. The contractor will use 1 μl of primary PCR product for the amplicon indexing.
6. The contractor will allow the submitter to: a) Quantify samples via fluorometric
method (such as Qubit or PicoGreen) and normalize all samples to
approximately the same concentration. b) Run products on a gel to confirm the
amplification was successful, the products are the expected size, and that offtarget
products (including primer-dimer) are not present, and provide a gel
image at the time of submission. Submittier is not required to clean up PCR
products prior to submission. If primer dimers or off-target products are
generated, then submitted will perform a clean-up to remove these products,
optimize the primary PCR reaction should, and/or do a Blue Pippin size
selection (separate transaction with the contractor).
7. Contractor will receive samples in a 96-well PCR-type plate, filled by column,
starting with A:1. Contractor should use well H:12 to perform a no-template
negative control.
2. Illumina Sequencing:
1. Must be able to complete amplicon gene amplicon sequencing, including:
1. With flexible read length options including 2 x 250 bp paired-end (PE)
reads.
2. Sample multiplexing with up to 500 samples/run
3. With data delivered directly to AOML/OCED researchers via external
servers and data availability for up to 1 year following completion of
sequencing
2. Must be able to conduct shotgun metagenomic sequencing, including:
1. Contractor must be able to accept pools of Illumina-compatible
sequencing libraries for sequencing on a NovaSeq 6000 S4 flow cell.
2. Contractor must be able to perform QC on library pools and quantify
using a combination of Qubit dsDNA, Agilent 4200 TapeStation High
Sensitivity DNA1000 and Invitrogen Collibri Illumina Library
Quantification qPCR kits.
3. Contractor must be able to sequence pools with expected output of
2,250M read pairs (675 Gbp) per lane.
4. Data should be delivered directly to AOML/OCED researchers via
external servers (eg, secure FTP) and data availability for up to 1 year
following completion of sequencing
The core mission of the Atlantic Oceanographic and Meteorological Laboratory (AOML) Ocean
Chemistry and Ecosystems Division centers on assessment of marine biodiversity, ecosystem
function, and resilience. As part of this mission, numerous projects rely on the genetic
analysis of hundreds to thousands of environmental DNA (“eDNA”) samples. This genetic
analysis requires highly technical molecular biological protocols: DNA quantification,
sequence library preparation, sequencing, and sequence data quality control. It is critical
that these steps are reproducible.
This Sources Sought is only for the purpose of identifying potential sources as part of
AOMLʼs market research. No Request for Quote (RFQ) exists; therefore, do not request a copy
of the RFQ.
Responses to this Sources Sought are not quotes on which AOML can issue any contract. This
Sources Sought is issued for information and planning purposes only and does not itself
constitute an RFQ. The Government does not intend to award a contract or BPA based only
on responses to this Sources Sought.
All information received in response to this Sources Sought marked "Proprietary" will be
protected and handled accordingly. Interested parties are responsible for adequately
marking proprietary or competition sensitive information contained in their response.
In response to this source sought, please provide:
1. Name of the firm, point of contact, phone number, email address, SAM Unique Entity
Identification Number (UEI), CAGE code, a statement regarding business status indicating
rather large or small (including small business type(s)/certifications(s) such as SDB, 8(a),
HUBZone, SDVOSB, WOSB, etc.) and the corresponding NAICS code for your business.
2. Information whether your firm already has technologies in place to meet the requirements
outlined.
3. Identify whether your firm is interested in competing for this requirement.
4. Provide any Information to help determine if the requirement is commercially available,
delivery schedules, customary terms and conditions, warranties, proprietary information, etc.
5. Provide any recommendations to improve the approach/specifications to acquiring the
identified item.
Responses to this Sources Sought will not be returned. Responders are solely responsible for
all expenses associated with responding to this Sources Sought. AOML will not pay for
information received in response to this Sources Sought.
Please send responses with the subject heading DNA SEQUENCING to Elizabeth Perez'sʼs email address: Elizabeth.Perez@noaa.gov by September 15, 2023 at
3:00pm EST.